جيهان عبدو
مرحبا بك اخي الزائر نحن ندعوك للانضمام الينا

دراسة الخبر الوراثي "د4"ج2"

اذهب الى الأسفل

default دراسة الخبر الوراثي "د4"ج2"

مُساهمة من طرف abdou في الجمعة 24 ديسمبر 2010, 10:43

انظر الروابط






علاقة
ARNm و تركيب
البروتينات:




نحضر
خلاصة بكتيريات تحتوي على كل المكونات السيتوبلاسمية لكن ينعدم فيها
ADN و
ARN ، بعد ذلك تضاف إليها أحماض
أمينية و ARNذائب
مستخلص من السيتوبلاسم.


ويمثل المبيان التالي النتائج المحصل:


دراسة الخبر الوراثي "د4"ج2" Rna

يتبين
أن بعد كل حقن لـ
ARN
يرتفع عدد الأحماض الأمينية المدمجة في البروتينات،و
بالتالي فان
ARN هو المسئول عن دمج الأحماض
الأمينية في البروتينات .


تركيب البروتينات:


* تجربة
Nirenberg
:


دراسة الخبر الوراثي "د4"ج2" Nirenb


توصل هذا العالم إلى مفهوم الرمز
الوراثي أي أن كل ثلاثية نيكليوتيدية ترمز إلى حمض أميني معين و تشكل بذلك
وحدة رمزية.


و بما أن عدد النيكليوتيدات هو 4 ، فعدد
التوافقات الممكنة
للإشارة إلى 20 حمض أميني طبيعي هو 43=
64 و هذا يعني

أن عدة وحدات رمزية
ترمز لحمض أميني واحد وبعضها لا يشير لأي حمض أميني( نقول
أنها بدون معنى) و تكون لائحة الوحدات الرمزية و
الأحماض الأمينية

المناسبة

لها
الرمز الوراثي

Le code génétique








خلاصة


الرمز الوراثي

Le code genetique


دراسة الخبر الوراثي "د4"ج2" Code


انظر الروابط




2




1

*
يحتاج
تركيب البروتينات
بالاضافة الى ARNm
و المورثة
الى:


* ريبوزومات
و هي عضيات سيتوبلاسمية صغيرة يتشكل كل واحد منها
من وحدة صغيرة و وحدة كبيرة، وتتكون كل وحدة من
ARN ريبوزومي (ARNr)
و من بروتينات سيتوبلاسمية.


*
ARN ناقل (ARNt)
الموجود بالسيتوبلاسم، ويختص بنقل الأحماض الأمينية الحرة حسب طبيعة
مضاد الوحدة الرمزية الموجود أسفل ARNt.


*
أحماض أمينية و هي 20 حمض أميني طبيعي.


*
طاقة لمختلف مراحل التركيب ، مصدرها الاستقلاب الطاقي.


*
عوامل منشطة


بعض الأحماض الأمينية


ARNt


ريبوزوم



ARNm




دراسة الخبر الوراثي "د4"ج2" Acamine




دراسة الخبر الوراثي "د4"ج2" Arnt




دراسة الخبر الوراثي "د4"ج2" Ribosome




دراسة الخبر الوراثي "د4"ج2" Arnm





الأحماض الأمينية
1


1 موقع
تثبيت الحمض الأميني


2 مضاد
الوحدة الرمزية


1 وحدة
ريبوزومية كبيرة


2 وحدة
ريبوزومية صغيرة



http://ici.cegep-ste-foy.qc.ca/profs/gbourbonnais/biotlm/planadn.htm


http://www.ac-versailles.fr/etabliss/herblay/genetiqu/fiches/iconeac.htm
http://www.astrosurf.com/macombes/fig14-5me.htm

* آلية تركيب البروتينات:

يمكن تلخيص
ظاهرة تركيب البروتينات
في ثلاثة مراحل
أساسية و هي:

* المرحلة الأولى:.البداية
انظر الرابط
-
تثبيت الوحدة الريبوزومية الصغرى على ARNm
الذي تكون وحدته الرمزية الأولى AUG

وصول ARNt حاملا معه
حمض أميني Met .

تثبيت الوحدة الريبوزومية الكبرى و بداية عمل الريبوزوم.

* المرحلة الثانية:الاستطالة

انظر الرابط

- وصول
ARNt آخر حاملا
معه حمض أميني مطابق للوحدة الرمزية الموالية .
-
تشكل رابطة بيبتيدية بين Met
و الحمض الأميني الموالي و انشطار الرابطة بين Met
و ARNt الذي يغادر
الريبوزوم (وجود طاقة ATP
)

يتحرك الريبوزوم بوحدة رمزية واحدة و هكذا تتضاعف الأحماض الأمينية في
السلسلة البيبتيدية.

* المرحلة الثالثة:النهاية

انظر الرابط
-
عندما يصل الريبوزوم إلى الوحدة الرمزية(UAA
أو UAG أو
UGA ) وهي بدون معنى أي أنها
لا تشير إلى أي حمض أميني يتوقف تركيب البروتين و هي تسمى

بذلك وحدات قف .




- تفترق
وحدتي الريبوزوم عن بعضهما البعض و عن ARNm
و يتم تحرير السلسلة البيبتيدية.

- ينفصل
الحمض الأميني Met عن
باقي السلسلة البيبتيدية
.

ملحوظة: تتم ترجمة جزيئة ARNm
عدة مرات من طرف مجموعة من الريبوزومات لكن بتأخير زمني وهذا ما يفسر تركيب
عدة جزيئات من نفس البروتين.

انظر الرابط

دراسة الخبر الوراثي "د4"ج2" Elongation







انظر الروابط


5


4


3


2


1









من
النسخ الوراثي إلى تركيب البروتينات


(برنامج للتحميل)fichier.zip

انسخ
ARNm
و ركب بروتين


مثال:

تمثل الوثيقة التالية
جزء من الخييط الغير مستنسخ لـ ADN
مورثة.


ATGCCCTGTGCCATCAAGTAA

1ـ اعط
متتالية الأحماض الأمينية المطابقة للبروتين
الذي تتحكم في تركيبه هذه المورثة.


حدد نتيجة استبدال النيكليوتيد
C رقم
10 من اللولب المستنسخ
بالنيكليوتيد A.


الإجابة


Selectionner ci-dessous pour voir la cerrection



1ـ الخييط المستنسخ لـ


adn


المكمل للخييط الغير مستنسخ هو:


TACGGGACACGGTAGTTCATT






خييط


ARNm

هو :


AUGCCCUGUGCCAUCAAGUAA






متتالية الأحماض
الأمينية المطابقة للبروتين المترجم هي :Met-
Pro- Cys-Ala-ILe-Lys



2ـ ستستبدل الثلاثية CGG
بـ AGG و من تم ستصبح
الثلاثية في ARNm كما
يلي UCC التي تترجم إلى
حمض أيني Ser عوض
Al

تمرين:

انظر الرابط
abdou
abdou
صاحب الموقع
صاحب الموقع

mms mms : دراسة الخبر الوراثي "د4"ج2" Empty
عدد المساهمات : 237
نقاط : 609
السٌّمعَة : 56
تاريخ الميلاد : 04/12/1961
تاريخ التسجيل : 25/10/2010
العمر : 57
الموقع : جيهان عبدو

بطاقة الشخصية
ع:

http://abdoubac.forummaroc.net

الرجوع الى أعلى الصفحة اذهب الى الأسفل

default رد: دراسة الخبر الوراثي "د4"ج2"

مُساهمة من طرف omayma chakira في السبت 25 ديسمبر 2010, 20:34

جزاك الله خيرا على
هذا الموضوع
omayma chakira
omayma chakira
عضو فعال
عضو فعال

عدد المساهمات : 212
نقاط : 306
السٌّمعَة : 51
تاريخ الميلاد : 24/04/1995
تاريخ التسجيل : 06/12/2010
العمر : 24

الرجوع الى أعلى الصفحة اذهب الى الأسفل

default رد: دراسة الخبر الوراثي "د4"ج2"

مُساهمة من طرف abdou في الأحد 26 ديسمبر 2010, 11:24



شكرا على مرورك

_________________
دراسة الخبر الوراثي "د4"ج2" 293900_2345269191602_1246171620_32877119_3579273_n
دراسة الخبر الوراثي "د4"ج2" 293900_2345269191602_1246171620_32877119_3579273_n
abdou
abdou
صاحب الموقع
صاحب الموقع

mms mms : دراسة الخبر الوراثي "د4"ج2" Empty
عدد المساهمات : 237
نقاط : 609
السٌّمعَة : 56
تاريخ الميلاد : 04/12/1961
تاريخ التسجيل : 25/10/2010
العمر : 57
الموقع : جيهان عبدو

بطاقة الشخصية
ع:

http://abdoubac.forummaroc.net

الرجوع الى أعلى الصفحة اذهب الى الأسفل

default رد: دراسة الخبر الوراثي "د4"ج2"

مُساهمة من طرف bacha في الخميس 05 مايو 2011, 17:50

موضوع جميل
bacha
bacha
عضو فعال
عضو فعال

عدد المساهمات : 127
نقاط : 201
السٌّمعَة : 28
تاريخ الميلاد : 18/09/1996
تاريخ التسجيل : 30/10/2010
العمر : 23

الرجوع الى أعلى الصفحة اذهب الى الأسفل

default رد: دراسة الخبر الوراثي "د4"ج2"

مُساهمة من طرف bacha salwa في الثلاثاء 09 أغسطس 2011, 17:48


موضوع رائع
bacha salwa
bacha salwa
نائب المدير
نائب المدير

mms mms : دراسة الخبر الوراثي "د4"ج2" Empty
عدد المساهمات : 141
نقاط : 279
السٌّمعَة : 57
تاريخ التسجيل : 26/11/2010

الرجوع الى أعلى الصفحة اذهب الى الأسفل

الرجوع الى أعلى الصفحة


 
صلاحيات هذا المنتدى:
لاتستطيع الرد على المواضيع في هذا المنتدى